twist2 (Proteintech)
Structured Review

Twist2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/anti+twist2/TWIST2+Antibody/pmc12410489-124-28-37
Average 93 stars, based on 23 article reviews
Images
1) Product Images from "SP1-Mediated upregulation of CLEC18B promotes the proliferation and metastasis of glioma through regulation of the Wnt/β-Catenin/EMT Pathway"
Article Title: SP1-Mediated upregulation of CLEC18B promotes the proliferation and metastasis of glioma through regulation of the Wnt/β-Catenin/EMT Pathway
Journal: Translational Oncology
doi: 10.1016/j.tranon.2025.102515
Figure Legend Snippet: Knockdown of CLEC18B suppresses glioma cell migration and invasion via Wnt/β-Catenin/EMT signaling. (A) Transwell migration and invasion assays showing reduced migratory and invasive abilities of U87 and U251 cells after CLEC18B knockdown. (B) Correlation between CLEC18B expression and Wnt/β-Catenin/EMT pathway gene expression in TCGA datasets. (C) Western blot analysis showing that CLEC18B knockdown suppresses the expression of mesenchymal markers (N-cadherin, Slug, Twist1, Twist2, Snail, and β-catenin) and promotes the expression of the epithelial marker E-cadherin.
Techniques Used: Knockdown, Migration, Expressing, Gene Expression, Western Blot, Marker
Related Articles
Blocking Assay:Article Title: Exosomal miR-155-5p derived from glioma stem-like cells promotes mesenchymal transition via targeting ACOT12. Article Snippet: .. After blocking with 5% normal goat serum, the slices were incubated with anti-ACOT12 (Thermo, MA5-25428), Article Title: Exosomal miR-155-5p derived from glioma stem-like cells promotes mesenchymal transition via targeting ACOT12 Article Snippet: .. After blocking with 5% normal goat serum, the slices were incubated with anti-ACOT12 (Thermo, MA5-25428), Incubation:Article Title: Exosomal miR-155-5p derived from glioma stem-like cells promotes mesenchymal transition via targeting ACOT12. Article Snippet: .. After blocking with 5% normal goat serum, the slices were incubated with anti-ACOT12 (Thermo, MA5-25428), Article Title: Exosomal miR-155-5p derived from glioma stem-like cells promotes mesenchymal transition via targeting ACOT12 Article Snippet: .. After blocking with 5% normal goat serum, the slices were incubated with anti-ACOT12 (Thermo, MA5-25428), Article Title: A Comparative Analysis Dissecting the Immune Landscape of Vitiligo and Melanoma from a single-cell Perspective: Two Sides of the Same Coin? Article Snippet: .. Sections were permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) and then blocked with 10% normal goat serum (Sigma-Aldrich) and incubated overnight at 4 °C with the following primary antibody: anti-PDGFRA (1: 200, MAB322, Biotechne), Article Title: A Comparative Analysis Dissecting the Immune Landscape of Vitiligo and Melanoma from a single-cell Perspective: Two Sides of the Same Coin? Article Snippet: .. Sections were permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) and then blocked with 10% normal goat serum (Sigma-Aldrich) and incubated overnight at 4 °C with the following primary antibody: anti-PDGFRA (1: 200, MAB322, Biotechne), Quantitative RT-PCR:Article Title: Exosomal miR-155-5p derived from glioma stem-like cells promotes mesenchymal transition via targeting ACOT12. Article Snippet: .. Oligos and antibodies used in the research. miR-155-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCT For miR-155-5p RT-qPCR miR-155-5p-F GCGCTTAATGCTAATCGTGAT miR-155-5p-R CCAGTGCAGGGTCCGAGGTA miR-574-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACACAC For miR-574-5p RT-qPCR miR-574-5p-F GGCTGAGTGTGTGTGTGTGA miR-574-5p-R CCAGTGCAGGGTCCGAGGTA miR-187-3p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCT For miR-187-3p RT-qPCR miR-187-3p-F GGCTCGTGTCTTGTGTTGC miR-187-3p-R CCAGTGCAGGGTCCGAGGTA miR-130a-3p-T GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGCCC For miR-130a-3p RT-qPCR miR-130a-3p-F GCGCCAGTGCAATGTTAAAA miR-130a-3p-R CCAGTGCAGGGTCCGAGGTA miR-181b-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCAC For miR-181b-5p RT-qPCR miR-181b-5p-F GCAACATTCATTGCTGTCG miR-181b-5p-R CCAGTGCAGGGTCCGAGGTA miR-361-5p-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTACCC For miR-361-5p RT-qPCR miR-361-5p-F GCGCTTATCAGAATCTCCAG miR-361-5p-R CCAGTGCAGGGTCCGAGGTA miR-16-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA For miR-16 RT-qPCR miR-16-F GCGCGCTAGCAGCACGTAAATA miR-16-R CCAGTGCAGGGTCCGAGGTA GAPDH-F GCACCGTCAAGGCTGAGAAC For GAPDH RT-qPCR GAPDH-R TGGTGAAGACGCCAGTGGA U6-F CTCGCTTCGGCAGCACA For U6 RT-qPCR U6-R AACGCTTCACGAATTTGCGT ACOT12-F TGCTGGAGTTTCCTGCGTTAC For ACOT12 RT-qPCR ACOT12-R GCATATCCTGTACCATGACCTTG TWIST2-F ACAGCAGTGACATCGGACAG For TWIST2 RT-qPCR TWIST2-R CCCCAAACATAAGACCCAGA Vimentin-F GAGAACTTTGCCGTTGAAGC For Vimentin RT-qPCR Vimentin-R GCTTCCTGTAGGTGGCAATC N-cadherin-F ACAGTGGCCACCTACAAAGG For N-cadherin RT-qPCR N-cadherin-R CCGAGATGGGGTTGATAATG Cell Death and Disease (2022) 13:725 antibodies were used: anti-CD63 (Abcam, Ab213090); anti-CD9 (Abcam, Ab92726); anti-GM130 (Abcam, Ab52649); anti-ACOT12 (Thermo, MA525428); |
